Review



pegfpc1 fusion mammalian protein expression vector  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    TaKaRa pegfpc1 fusion mammalian protein expression vector
    Figure 2: Co-immunoprecipitation experiments in HEK293 cells transfected with (A) pEF-BOS-SNAP25-FLAG alone or together with <t>pEGFPC1-TrkB.</t> (B) pEF-BOS-VAMP2-FLAG alone or together with pEGFPC1-TrkB. (C) pEF-BOS-SNAP25-FLAG, pEF-BOS- VAMP2-FLAG and TrkA-HA. (D) pEF-BOS-SNAP25-FLAG, pEF-BOS-VAMP2-FLAG and TrkC-myc. No co-immunoprecipitation was observed between proteins analyzed with anti α-GFP, anti-myc, anti-FLAG, or anti-HA antibodies. Two transfections in HEK cells per condition were run in parallel for each experiment and three experiments were done. Arrows indicate specific bands.
    Pegfpc1 Fusion Mammalian Protein Expression Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 15993 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pegfpc1+fusion+mammalian+protein+expression+vector/EcoR+I/pm30542508-242-18-24
    Average 99 stars, based on 15993 article reviews
    pegfpc1 fusion mammalian protein expression vector - by Bioz Stars, 2026-10
    99/100 stars

    Images

    1) Product Images from "Syntaxin-1/TI-VAMP SNAREs interact with Trk receptors and are required for neurotrophin-dependent outgrowth."

    Article Title: Syntaxin-1/TI-VAMP SNAREs interact with Trk receptors and are required for neurotrophin-dependent outgrowth.

    Journal: Oncotarget

    doi: 10.18632/oncotarget.26307

    Figure 2: Co-immunoprecipitation experiments in HEK293 cells transfected with (A) pEF-BOS-SNAP25-FLAG alone or together with pEGFPC1-TrkB. (B) pEF-BOS-VAMP2-FLAG alone or together with pEGFPC1-TrkB. (C) pEF-BOS-SNAP25-FLAG, pEF-BOS- VAMP2-FLAG and TrkA-HA. (D) pEF-BOS-SNAP25-FLAG, pEF-BOS-VAMP2-FLAG and TrkC-myc. No co-immunoprecipitation was observed between proteins analyzed with anti α-GFP, anti-myc, anti-FLAG, or anti-HA antibodies. Two transfections in HEK cells per condition were run in parallel for each experiment and three experiments were done. Arrows indicate specific bands.
    Figure Legend Snippet: Figure 2: Co-immunoprecipitation experiments in HEK293 cells transfected with (A) pEF-BOS-SNAP25-FLAG alone or together with pEGFPC1-TrkB. (B) pEF-BOS-VAMP2-FLAG alone or together with pEGFPC1-TrkB. (C) pEF-BOS-SNAP25-FLAG, pEF-BOS- VAMP2-FLAG and TrkA-HA. (D) pEF-BOS-SNAP25-FLAG, pEF-BOS-VAMP2-FLAG and TrkC-myc. No co-immunoprecipitation was observed between proteins analyzed with anti α-GFP, anti-myc, anti-FLAG, or anti-HA antibodies. Two transfections in HEK cells per condition were run in parallel for each experiment and three experiments were done. Arrows indicate specific bands.

    Techniques Used: Immunoprecipitation, Transfection

    Related Articles

    Clone Assay:

    Article Title: A Signaling Mechanism Coupling Netrin-1/Deleted in Colorectal Cancer Chemoattraction to SNARE-Mediated Exocytosis in Axonal Growth Cones
    Article Snippet: .. Full-length Sytx1A or truncated DNAs (Sytx1ACYT, Sytx1AHabc, Sytx1AH3TM, Sytx1AH3, and Sytx1ATM) were cloned into EcoRI sites in pEGFPC1 fusion mammalian protein expression vector (Clontech). ..

    Article Title: Syntaxin-1/TI-VAMP SNAREs interact with Trk receptors and are required for neurotrophin-dependent outgrowth.
    Article Snippet: .. Full-length Sytx1A or truncated DNAs (Sytx1 ACYT, Sytx1AHabc, Sytx1AH3TM, Sytx1AH3, and Sytx1ATM) were cloned into EcoRI sites in pEGFPC1 fusion mammalian protein expression vector (Clontech), as described [18]. .. Primary culture and explant transfection Using the NeonTM transfection system (Invitrogen), nodose-dissociated primary cultures were transfected with one of the following DNAs: pEGFPC1, Sytx1AH3TMEGFP, shRNA TI-VAMP D06 (5′CCGGGCACTTCCTTATGC TATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTT TTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD06) and shRNA TI-VAMP D07 (5′CCGGCTTACTCACATGG CAATTATTCTCGAGAATAATTGCCATGTGAGTAAGTT TTTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD07).

    Article Title: Syntaxin-1/TI-VAMP SNAREs interact with Trk receptors and are required for neurotrophin-dependent outgrowth
    Article Snippet: .. Full-length Sytx1A or truncated DNAs (Sytx1ACYT, Sytx1AHabc, Sytx1AH3TM, Sytx1AH3, and Sytx1ATM) were cloned into EcoRI sites in pEGFPC1 fusion mammalian protein expression vector (Clontech), as described [ ]. .. Using the NeonTM transfection system (Invitrogen), nodose-dissociated primary cultures were transfected with one of the following DNAs: pEGFPC1, Sytx1AH3TMEGFP, shRNA TI-VAMP D06 (5′CCGGGCACTTCCTTATGCTATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTTTTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD06) and shRNA TI-VAMP D07 (5′CCGGCTTACTCACATGGCAATTATTCTCGAGAATAATTGCCATGTGAGTAAGTTTTTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD07).

    Article Title: Syntaxin 1 is required for DCC/Netrin-1-dependent chemoattraction of migrating neurons from the lower rhombic lip.
    Article Snippet: Directed cell migration and axonal guidance are essential steps in neural development that share many molecular mechanisms.. The guidance of developing axons and migrating neurons is likely to depend on the precise control of plasmalemma turnover in selected regions of leading edges and growth cones, respectively.. Previous results provided evidence of a signaling mechanism that couples chemotropic deleted in colorectal cancer (DCC) ⁄ Netrin-1 axonal guidance and exocytosis through Syntaxin1(Sytx1) ⁄ TI-VAMP SNARE proteins.

    Expressing:

    Article Title: A Signaling Mechanism Coupling Netrin-1/Deleted in Colorectal Cancer Chemoattraction to SNARE-Mediated Exocytosis in Axonal Growth Cones
    Article Snippet: .. Full-length Sytx1A or truncated DNAs (Sytx1ACYT, Sytx1AHabc, Sytx1AH3TM, Sytx1AH3, and Sytx1ATM) were cloned into EcoRI sites in pEGFPC1 fusion mammalian protein expression vector (Clontech). ..

    Article Title: Syntaxin-1/TI-VAMP SNAREs interact with Trk receptors and are required for neurotrophin-dependent outgrowth.
    Article Snippet: .. Full-length Sytx1A or truncated DNAs (Sytx1 ACYT, Sytx1AHabc, Sytx1AH3TM, Sytx1AH3, and Sytx1ATM) were cloned into EcoRI sites in pEGFPC1 fusion mammalian protein expression vector (Clontech), as described [18]. .. Primary culture and explant transfection Using the NeonTM transfection system (Invitrogen), nodose-dissociated primary cultures were transfected with one of the following DNAs: pEGFPC1, Sytx1AH3TMEGFP, shRNA TI-VAMP D06 (5′CCGGGCACTTCCTTATGC TATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTT TTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD06) and shRNA TI-VAMP D07 (5′CCGGCTTACTCACATGG CAATTATTCTCGAGAATAATTGCCATGTGAGTAAGTT TTTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD07).

    Article Title: Syntaxin-1/TI-VAMP SNAREs interact with Trk receptors and are required for neurotrophin-dependent outgrowth
    Article Snippet: .. Full-length Sytx1A or truncated DNAs (Sytx1ACYT, Sytx1AHabc, Sytx1AH3TM, Sytx1AH3, and Sytx1ATM) were cloned into EcoRI sites in pEGFPC1 fusion mammalian protein expression vector (Clontech), as described [ ]. .. Using the NeonTM transfection system (Invitrogen), nodose-dissociated primary cultures were transfected with one of the following DNAs: pEGFPC1, Sytx1AH3TMEGFP, shRNA TI-VAMP D06 (5′CCGGGCACTTCCTTATGCTATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTTTTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD06) and shRNA TI-VAMP D07 (5′CCGGCTTACTCACATGGCAATTATTCTCGAGAATAATTGCCATGTGAGTAAGTTTTTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD07).

    Article Title: Syntaxin 1 is required for DCC/Netrin-1-dependent chemoattraction of migrating neurons from the lower rhombic lip.
    Article Snippet: Directed cell migration and axonal guidance are essential steps in neural development that share many molecular mechanisms.. The guidance of developing axons and migrating neurons is likely to depend on the precise control of plasmalemma turnover in selected regions of leading edges and growth cones, respectively.. Previous results provided evidence of a signaling mechanism that couples chemotropic deleted in colorectal cancer (DCC) ⁄ Netrin-1 axonal guidance and exocytosis through Syntaxin1(Sytx1) ⁄ TI-VAMP SNARE proteins.

    Plasmid Preparation:

    Article Title: A Signaling Mechanism Coupling Netrin-1/Deleted in Colorectal Cancer Chemoattraction to SNARE-Mediated Exocytosis in Axonal Growth Cones
    Article Snippet: .. Full-length Sytx1A or truncated DNAs (Sytx1ACYT, Sytx1AHabc, Sytx1AH3TM, Sytx1AH3, and Sytx1ATM) were cloned into EcoRI sites in pEGFPC1 fusion mammalian protein expression vector (Clontech). ..

    Article Title: Syntaxin-1/TI-VAMP SNAREs interact with Trk receptors and are required for neurotrophin-dependent outgrowth.
    Article Snippet: .. Full-length Sytx1A or truncated DNAs (Sytx1 ACYT, Sytx1AHabc, Sytx1AH3TM, Sytx1AH3, and Sytx1ATM) were cloned into EcoRI sites in pEGFPC1 fusion mammalian protein expression vector (Clontech), as described [18]. .. Primary culture and explant transfection Using the NeonTM transfection system (Invitrogen), nodose-dissociated primary cultures were transfected with one of the following DNAs: pEGFPC1, Sytx1AH3TMEGFP, shRNA TI-VAMP D06 (5′CCGGGCACTTCCTTATGC TATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTT TTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD06) and shRNA TI-VAMP D07 (5′CCGGCTTACTCACATGG CAATTATTCTCGAGAATAATTGCCATGTGAGTAAGTT TTTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD07).

    Article Title: Syntaxin-1/TI-VAMP SNAREs interact with Trk receptors and are required for neurotrophin-dependent outgrowth
    Article Snippet: .. Full-length Sytx1A or truncated DNAs (Sytx1ACYT, Sytx1AHabc, Sytx1AH3TM, Sytx1AH3, and Sytx1ATM) were cloned into EcoRI sites in pEGFPC1 fusion mammalian protein expression vector (Clontech), as described [ ]. .. Using the NeonTM transfection system (Invitrogen), nodose-dissociated primary cultures were transfected with one of the following DNAs: pEGFPC1, Sytx1AH3TMEGFP, shRNA TI-VAMP D06 (5′CCGGGCACTTCCTTATGCTATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTTTTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD06) and shRNA TI-VAMP D07 (5′CCGGCTTACTCACATGGCAATTATTCTCGAGAATAATTGCCATGTGAGTAAGTTTTTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD07).

    Article Title: Syntaxin 1 is required for DCC/Netrin-1-dependent chemoattraction of migrating neurons from the lower rhombic lip.
    Article Snippet: Directed cell migration and axonal guidance are essential steps in neural development that share many molecular mechanisms.. The guidance of developing axons and migrating neurons is likely to depend on the precise control of plasmalemma turnover in selected regions of leading edges and growth cones, respectively.. Previous results provided evidence of a signaling mechanism that couples chemotropic deleted in colorectal cancer (DCC) ⁄ Netrin-1 axonal guidance and exocytosis through Syntaxin1(Sytx1) ⁄ TI-VAMP SNARE proteins.

    Control:

    Article Title: Syntaxin 1 is required for DCC/Netrin-1-dependent chemoattraction of migrating neurons from the lower rhombic lip.
    Article Snippet: Directed cell migration and axonal guidance are essential steps in neural development that share many molecular mechanisms.. The guidance of developing axons and migrating neurons is likely to depend on the precise control of plasmalemma turnover in selected regions of leading edges and growth cones, respectively.. Previous results provided evidence of a signaling mechanism that couples chemotropic deleted in colorectal cancer (DCC) ⁄ Netrin-1 axonal guidance and exocytosis through Syntaxin1(Sytx1) ⁄ TI-VAMP SNARE proteins.



    Similar Products

    pegfpc1 fusion mammalian protein expression vector  (TaKaRa)
    99
    TaKaRa pegfpc1 fusion mammalian protein expression vector
    Figure 2: Co-immunoprecipitation experiments in HEK293 cells transfected with (A) pEF-BOS-SNAP25-FLAG alone or together with <t>pEGFPC1-TrkB.</t> (B) pEF-BOS-VAMP2-FLAG alone or together with pEGFPC1-TrkB. (C) pEF-BOS-SNAP25-FLAG, pEF-BOS- VAMP2-FLAG and TrkA-HA. (D) pEF-BOS-SNAP25-FLAG, pEF-BOS-VAMP2-FLAG and TrkC-myc. No co-immunoprecipitation was observed between proteins analyzed with anti α-GFP, anti-myc, anti-FLAG, or anti-HA antibodies. Two transfections in HEK cells per condition were run in parallel for each experiment and three experiments were done. Arrows indicate specific bands.
    Pegfpc1 Fusion Mammalian Protein Expression Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pegfpc1+fusion+mammalian+protein+expression+vector/EcoR+I/pm30542508-242-18-24
    Average 99 stars, based on 1 article reviews
    pegfpc1 fusion mammalian protein expression vector - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Figure 2: Co-immunoprecipitation experiments in HEK293 cells transfected with (A) pEF-BOS-SNAP25-FLAG alone or together with pEGFPC1-TrkB. (B) pEF-BOS-VAMP2-FLAG alone or together with pEGFPC1-TrkB. (C) pEF-BOS-SNAP25-FLAG, pEF-BOS- VAMP2-FLAG and TrkA-HA. (D) pEF-BOS-SNAP25-FLAG, pEF-BOS-VAMP2-FLAG and TrkC-myc. No co-immunoprecipitation was observed between proteins analyzed with anti α-GFP, anti-myc, anti-FLAG, or anti-HA antibodies. Two transfections in HEK cells per condition were run in parallel for each experiment and three experiments were done. Arrows indicate specific bands.

    Journal: Oncotarget

    Article Title: Syntaxin-1/TI-VAMP SNAREs interact with Trk receptors and are required for neurotrophin-dependent outgrowth.

    doi: 10.18632/oncotarget.26307

    Figure Lengend Snippet: Figure 2: Co-immunoprecipitation experiments in HEK293 cells transfected with (A) pEF-BOS-SNAP25-FLAG alone or together with pEGFPC1-TrkB. (B) pEF-BOS-VAMP2-FLAG alone or together with pEGFPC1-TrkB. (C) pEF-BOS-SNAP25-FLAG, pEF-BOS- VAMP2-FLAG and TrkA-HA. (D) pEF-BOS-SNAP25-FLAG, pEF-BOS-VAMP2-FLAG and TrkC-myc. No co-immunoprecipitation was observed between proteins analyzed with anti α-GFP, anti-myc, anti-FLAG, or anti-HA antibodies. Two transfections in HEK cells per condition were run in parallel for each experiment and three experiments were done. Arrows indicate specific bands.

    Article Snippet: Full-length Sytx1A or truncated DNAs (Sytx1 ACYT, Sytx1AHabc, Sytx1AH3TM, Sytx1AH3, and Sytx1ATM) were cloned into EcoRI sites in pEGFPC1 fusion mammalian protein expression vector (Clontech), as described [18].

    Techniques: Immunoprecipitation, Transfection